Review



control scrambled shrna lentivirus  (OriGene)


Bioz Verified Symbol OriGene is a verified supplier
Bioz Manufacturer Symbol OriGene manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    OriGene control scrambled shrna lentivirus
    Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/bio_rxiv__64898__2026__05__07__723592-192-12-17?v=OriGene
    Average 95 stars, based on 134 article reviews
    control scrambled shrna lentivirus - by Bioz Stars, 2026-08
    95/100 stars

    Images



    Similar Products

    shrna scrambled control lentivirus plasmids  (Genecopoeia)
    90
    Genecopoeia shrna scrambled control lentivirus plasmids
    KEY RESOURCES TABLE
    Shrna Scrambled Control Lentivirus Plasmids, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pmc11372658-62-0-6?v=Genecopoeia
    Average 90 stars, based on 1 article reviews
    shrna scrambled control lentivirus plasmids - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    control scrambled shrna lentivirus  (OriGene)
    95
    OriGene control scrambled shrna lentivirus
    KEY RESOURCES TABLE
    Control Scrambled Shrna Lentivirus, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/bio_rxiv__64898__2026__05__07__723592-192-12-17?v=OriGene
    Average 95 stars, based on 1 article reviews
    control scrambled shrna lentivirus - by Bioz Stars, 2026-08
    95/100 stars
    		  Buy from Supplier
    scramble control shrna lentivirus  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology scramble control shrna lentivirus
    KEY RESOURCES TABLE
    Scramble Control Shrna Lentivirus, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pm41709508-91-39-44?v=Santa+Cruz+Biotechnology
    Average 96 stars, based on 1 article reviews
    scramble control shrna lentivirus - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    lentivirus vectors carrying yap1 specific shrna yap1- shrna (trcn0000107268) and its negative control (scramble)  (GenScript corporation)
    90
    GenScript corporation lentivirus vectors carrying yap1 specific shrna yap1- shrna (trcn0000107268) and its negative control (scramble)
    KEY RESOURCES TABLE
    Lentivirus Vectors Carrying Yap1 Specific Shrna Yap1 Shrna (Trcn0000107268) And Its Negative Control (Scramble), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pm40070092-48-20-34?v=GenScript+corporation
    Average 90 stars, based on 1 article reviews
    lentivirus vectors carrying yap1 specific shrna yap1- shrna (trcn0000107268) and its negative control (scramble) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    scrambled control shrna lentivirus particles  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology scrambled control shrna lentivirus particles
    KEY RESOURCES TABLE
    Scrambled Control Shrna Lentivirus Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pm39741183-60-1-9?v=Santa+Cruz+Biotechnology
    Average 90 stars, based on 1 article reviews
    scrambled control shrna lentivirus particles - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    lentivirus containing the mouse shslc7a5 and shrna scramble sequence (negative control)  (Shanghai Genechem Ltd)
    90
    Shanghai Genechem Ltd lentivirus containing the mouse shslc7a5 and shrna scramble sequence (negative control)
    KEY RESOURCES TABLE
    Lentivirus Containing The Mouse Shslc7a5 And Shrna Scramble Sequence (Negative Control), supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/10__3892_slash_ol__2024__14772-53-1-15?v=Shanghai+Genechem+Ltd
    Average 90 stars, based on 1 article reviews
    lentivirus containing the mouse shslc7a5 and shrna scramble sequence (negative control) - by Bioz Stars, 2026-08
    90/100 stars
    		  Buy from Supplier
    control lentivirus shuttle plasmid  (Addgene inc)
    96
    Addgene inc control lentivirus shuttle plasmid
    KEY RESOURCES TABLE
    Control Lentivirus Shuttle Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pmc11585690-50-11-19?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    control lentivirus shuttle plasmid - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier
    lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact  (OriGene)
    96
    OriGene lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact
    Knockdown of Ndst1 in primary mouse astrocytes lowers levels of intracellular liposomes (A) Micrographs showing levels of lipid droplets (LD), a marker for lentiviral transfection (green), and nuclear stain (DAPI, blue) in control, cells transfected with either a scramble sequence <t>shRNA</t> vector or one targeting Ndst1. Ndst1 shRNA produced reduced levels of LD number and volume (panels on the right), as well as decreases in Plin2 expression measured by qPCR. (B) The effect of Ndst1 shRNA was evaluated on astrocytes from animals expressing humanized variants of APOE3 and APOE4. LD volumes were significantly reduced by Ndst1 knockdown compared to scramble controls in astrocytes from either of these two genotypes [images show individual cells, nuclei (blue), and LD (red), and graphs provide quantitation of LD volumes. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001). Error bars represent SEM.
    Lentivirus Negative Scramble Shrna Target Sequence Gcactaccagagctaactcagatagtact, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/control+scrambled+shrna+lentivirus/pmc11302002-2-0-8?v=OriGene
    Average 96 stars, based on 1 article reviews
    lentivirus negative scramble shrna target sequence gcactaccagagctaactcagatagtact - by Bioz Stars, 2026-08
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: A therapeutically targetable positive feedback loop between lnc-HLX-2-7 , HLX, and MYC that promotes group 3 medulloblastoma

    doi: 10.1016/j.celrep.2024.113938

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: shRNA Scrambled Control lentivirus plasmids , GeneCopoeia , Cat# CSHCTR001-LVRU6GP.

    Techniques: Recombinant, Clone Assay, Luciferase, TUNEL Assay, Control, Negative Control, shRNA, Plasmid Preparation, Software, Imaging, Fluorescence, Microscopy

    Knockdown of Ndst1 in primary mouse astrocytes lowers levels of intracellular liposomes (A) Micrographs showing levels of lipid droplets (LD), a marker for lentiviral transfection (green), and nuclear stain (DAPI, blue) in control, cells transfected with either a scramble sequence shRNA vector or one targeting Ndst1. Ndst1 shRNA produced reduced levels of LD number and volume (panels on the right), as well as decreases in Plin2 expression measured by qPCR. (B) The effect of Ndst1 shRNA was evaluated on astrocytes from animals expressing humanized variants of APOE3 and APOE4. LD volumes were significantly reduced by Ndst1 knockdown compared to scramble controls in astrocytes from either of these two genotypes [images show individual cells, nuclei (blue), and LD (red), and graphs provide quantitation of LD volumes. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001). Error bars represent SEM.

    Journal: iScience

    Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

    doi: 10.1016/j.isci.2024.110256

    Figure Lengend Snippet: Knockdown of Ndst1 in primary mouse astrocytes lowers levels of intracellular liposomes (A) Micrographs showing levels of lipid droplets (LD), a marker for lentiviral transfection (green), and nuclear stain (DAPI, blue) in control, cells transfected with either a scramble sequence shRNA vector or one targeting Ndst1. Ndst1 shRNA produced reduced levels of LD number and volume (panels on the right), as well as decreases in Plin2 expression measured by qPCR. (B) The effect of Ndst1 shRNA was evaluated on astrocytes from animals expressing humanized variants of APOE3 and APOE4. LD volumes were significantly reduced by Ndst1 knockdown compared to scramble controls in astrocytes from either of these two genotypes [images show individual cells, nuclei (blue), and LD (red), and graphs provide quantitation of LD volumes. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001). Error bars represent SEM.

    Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

    Techniques: Knockdown, Liposomes, Marker, Transfection, Staining, Control, Sequencing, shRNA, Plasmid Preparation, Produced, Expressing, Quantitation Assay

    Journal: iScience

    Article Title: Altering heparan sulfate suppresses cell abnormalities and neuron loss in Drosophila presenilin model of Alzheimer Disease

    doi: 10.1016/j.isci.2024.110256

    Figure Lengend Snippet:

    Article Snippet: Lentivirus Negative Scramble shRNA Target Sequence: GCACTACCAGAGCTAACTCAGATAGTACT , Origene , Cat#TR30021.

    Techniques: Virus, shRNA, Sequencing, Recombinant, Staining, Synthesized, Transfection, Software, RNA Sequencing